Desain Primer Spesifik dari 12S rRNA Mendeteksi Spesies pada Daging

PURUHITA, PURUHITA (2017) Desain Primer Spesifik dari 12S rRNA Mendeteksi Spesies pada Daging. Other thesis, Universitas Sebelas Maret.

[img] PDF - Published Version
Download (322Kb)

    Abstract

    ABSTRAK Teknik polymerase chain reaction (PCR) merupakan salah satu teknik yang digunakan untuk mendeteksi spesies pada daging. Amplifikasi DNA dengan PCR memerlukan sepasang primer (forward dan reverse) untuk membatasi daerah yang ingin diamplifikasi. Penelitian ini bertujuan untuk memperoleh primer spesifik yang digunakan untuk membatasi daerah amplifikasi terhadap gen 12S rRNA dari DNA mitokondria (mt-DNA) pada spesies sapi, babi dan ayam yang didesain menggunakan program PRIMER3. Desain primer dilakukan melalui tahapan yang meliputi penelusuran sekuen gen dari bank data NCBI, analisis alignment sekuen gen 12S rRNA, pemilihan kandidat primer dari PRIMER3, deteksi spesies dengan PCR dan analisis sekuen hasil PCR. Penelitian ini telah berhasil memperoleh primer forward dari sekuen mt-DNA gen 12S rRNA ketiga spesies (ACCGCGGTCATACGATTAAC) dan primer reverse yang didesain spesifik untuk masing-masing spesies sapi (AGTGCGTCGGCTA-TTGTAGG), babi (GAATTGGCAAGGGTTGGTAA) dan ayam (CGGTATGTACGTGCCTC-AGA). Primer didesain dengan perbedaan panjang fragmen dari tiga jenis daging yang berbeda. Primer ini dapat mengamplifikasi gen 12S rRNA dengan panjang fragmen 155 bp (sapi), 357 bp (babi) dan 611 bp (ayam). Pengujian primer dilakukan dengan mencampur primer dalam reaksi PCR untuk mengetahui bahwa primer yang didesain dapat mengamplifkasi DNA target. Identifikasi dilakukan dengan visualisasi hasil elektroforesis produk PCR. Hasil penelitian ini menunjukkan bahwa primer yang didesain dari gen 12S rRNA dapat digunakan untuk mendeteksi spesies pada daging dengan menggunakan teknik PCR. Kata kunci : Desain primer, 12S rRNA, Deteksi spesies, PCR

    Item Type: Thesis (Other)
    Subjects: S Agriculture > S Agriculture (General)
    Divisions: Fakultas Pertanian > Peternakan
    Depositing User: Faricha Rizqi
    Date Deposited: 20 Dec 2017 17:19
    Last Modified: 20 Dec 2017 17:19
    URI: https://eprints.uns.ac.id/id/eprint/37719

    Actions (login required)

    View Item