KEANEKARAGAMAN GEN PENYANDI αS1-KASEIN (CSN1S1) DARI GENOM DARAH KAMBING PERANAKAN ETTAWA (PE) DI JAWA TENGAH

ADITAMA, DIAN (2014) KEANEKARAGAMAN GEN PENYANDI αS1-KASEIN (CSN1S1) DARI GENOM DARAH KAMBING PERANAKAN ETTAWA (PE) DI JAWA TENGAH. Other thesis, Universitas Sebelas Maret.

[img]
Preview
PDF - Published Version
Download (62Kb) | Preview

    Abstract

    Kambing peranakan ettawa (PE) banyak dikembangkan sebagai ternak penghasil susu di Jawa Tengah. Komponen utama pada susu terdiri dari 4 protein kasein, salah satunya adalah αs1- kasein. Tujuan dari penelitian ini adalah untuk mengetahui keanekaragaman pada gen penyandi αs1- kasein dari genom darah kambing peranakan ettawa (PE) di Jawa Tengah. Ekstraksi DNA genom darah kambing peranakan ettawa (PE) dengan menggunakan GenJET Genomic DNA Purification Column. Amplifikasi gen as1-kasein menggunakan primer sebagai berikut: F: 5’TTCTAAAAGTCTCAGAGGCAG3’ dan R: 5’GGGTTGATAGC CTTGTATGT3’. Keanekaragaman gen penyandi αs1- kasein dianalisis menggunakan metode PCR-RFLP (Reaction Fragment Length Polymorphism) dengan menggunakan enzim retriksi XmnI. Data hasil digesti dengan menggunakan enzim retriksi XmnI yang diperoleh dianalisis secara deskripsi. Berdasarkan analisis RFLP diperoleh 8 alel yakni AA, BB, AB, AC, AD, BC, BD dan CD dengan frekuensi berturut – turut 22%, 28%, 6%, 8%, 12%, 12%, 8% dan 4%. Kata kunci: Alel, αs1- kasein, GenJET, PCR-RFLP

    Item Type: Thesis (Other)
    Subjects: Q Science > Q Science (General)
    Q Science > QH Natural history > QH301 Biology
    Divisions: Fakultas Matematika dan Ilmu Pengetahuan Alam
    Fakultas Matematika dan Ilmu Pengetahuan Alam > Biologi
    Depositing User: Natasya Andalucki Yohosua
    Date Deposited: 28 Sep 2015 14:44
    Last Modified: 28 Sep 2015 14:44
    URI: https://eprints.uns.ac.id/id/eprint/19671

    Actions (login required)

    View Item